Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07619
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209550
Product ID ORK07619
Clone name fk12521
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF486
cDNA sequence DNA sequence (3602 bp)
Predicted protein sequence (403 aa)
Description Homo sapiens mRNA for PREDICTED: KRAB domain only 2 variant protein.
Features of the cloned cDNA sequence

Length: 3602 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2390 bp
Genome contig ID gi42406306f_20057819
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTTATGTAATAAAATGCAGTGCATTTAAAAATTGT
Flanking genome sequence
(114482 - 114531)
----+----*----+----*----+----*----+----*----+----*
TAGATTATGTGTGAATTTAATTTTATGTTTTTTACCATGTTAAGACTATT

Features of the protein sequence

Length: 403 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92787 3.1e-177 100.0 KRAB domain onl...
Homo sapiens
AAI17269 3.4e-177 100.0 Zinc finger pro...
Homo sapiens
AAH27608 7.2e-176 99.5 ZNF486 protein ...
Homo sapiens
XP_512535 3.1e-172 97.2 zinc finger pro...
Pan troglodytes
O75373 2.4e-128 73.5 Zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 150 173 PD000003 Zinc finger
IPR007087 178 201 PD000003 Zinc finger
IPR007087 206 229 PD000003 Zinc finger
IPR007087 234 257 PD000003 Zinc finger
IPR007087 262 285 PD000003 Zinc finger
IPR007087 290 313 PD000003 Zinc finger
IPR007087 318 341 PD000003 Zinc finger
IPR007087 346 369 PD000003 Zinc finger
IPR007087 374 396 PD000003 Zinc finger
HMMPfam IPR007087 150 172 PF00096 Zinc finger
IPR007087 178 200 PF00096 Zinc finger
IPR007087 206 228 PF00096 Zinc finger
IPR007087 234 256 PF00096 Zinc finger
IPR007087 262 284 PF00096 Zinc finger
IPR007087 290 312 PF00096 Zinc finger
IPR007087 318 340 PF00096 Zinc finger
IPR007087 346 368 PF00096 Zinc finger
IPR007087 374 396 PF00096 Zinc finger
HMMSmart IPR015880 94 116 SM00355 Zinc finger
IPR015880 150 172 SM00355 Zinc finger
IPR015880 178 200 SM00355 Zinc finger
IPR015880 206 228 SM00355 Zinc finger
IPR015880 234 256 SM00355 Zinc finger
IPR015880 262 284 SM00355 Zinc finger
IPR015880 290 312 SM00355 Zinc finger
IPR015880 318 340 SM00355 Zinc finger
IPR015880 346 368 SM00355 Zinc finger
IPR015880 374 396 SM00355 Zinc finger
ProfileScan IPR007087 94 121 PS50157 Zinc finger
IPR007087 150 177 PS50157 Zinc finger
IPR007087 178 205 PS50157 Zinc finger
IPR007087 206 233 PS50157 Zinc finger
IPR007087 234 261 PS50157 Zinc finger
IPR007087 262 289 PS50157 Zinc finger
IPR007087 290 317 PS50157 Zinc finger
IPR007087 318 345 PS50157 Zinc finger
IPR007087 346 373 PS50157 Zinc finger
IPR007087 374 401 PS50157 Zinc finger
ScanRegExp IPR007087 152 172 PS00028 Zinc finger
IPR007087 180 200 PS00028 Zinc finger
IPR007087 208 228 PS00028 Zinc finger
IPR007087 236 256 PS00028 Zinc finger
IPR007087 264 284 PS00028 Zinc finger
IPR007087 292 312 PS00028 Zinc finger
IPR007087 320 340 PS00028 Zinc finger
IPR007087 348 368 PS00028 Zinc finger
IPR007087 376 396 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp