Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07651
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209035
Product ID ORK07651
Clone name hh01240
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MYO19
cDNA sequence DNA sequence (5743 bp)
Predicted protein sequence (638 aa)
Description myosin head domain containing 1 isoform 1
Features of the cloned cDNA sequence

Length: 5743 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2882 bp
Genome contig ID gi51511734r_31825595
PolyA signal sequence
(AGTAAA,-18)
+----*----+----*----+----*----+----
CTATCAACTGTACCAAAAGTAAAACATTTAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCATCTGAATGTCAAGTTTTCTCTCCATAAAGGACTTGCCACCTTAAG

Features of the protein sequence

Length: 638 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92272 0 100.0 myosin head dom...
Homo sapiens
Q96H55 0 99.8 Myosin-XIX; Myo...
Homo sapiens
BAG64980 0 99.6 unnamed protein...
Homo sapiens
XP_001173723 0 99.3 myosin head dom...
Pan troglodytes
XP_001173690 0 99.3 myosin head dom...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 171 201 PD000355 Myosin head
FPrintScan IPR001609 67 86 PR00193 Myosin head
IPR001609 127 152 PR00193 Myosin head
IPR001609 179 206 PR00193 Myosin head
IPR001609 411 439 PR00193 Myosin head
IPR001609 464 492 PR00193 Myosin head
HMMPfam IPR001609 39 252 PF00063 Myosin head
IPR001609 278 633 PF00063 Myosin head
HMMSmart IPR001609 31 637 SM00242 Myosin head
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp