ORK07669

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07669

Order Kazusa clone(s) from :

Accession No	AB209082
Product ID	ORK07669
Clone name	hk04568
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RGPD6
cDNA sequence	DNA sequence (4063 bp) Predicted protein sequence (757 aa)
Description	Homo sapiens mRNA for RAN-binding protein 2-like 1 isoform 1 variant protein.

Features of the cloned cDNA sequence

Description

Length: 4063 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1789 bp
Genome contig ID	gi89161199f_108649380
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTATTTTAATATTTCTATTAAAACTGTATATTTTT
Flanking genome sequence (1323173 - 1323222)	----+--------+--------+--------+--------+----* ATGGCTGCTCTTTTATGTTACCCACTGTCTCTTTGGGGTTGTTAATTGGT

Features of the protein sequence

Description

Length: 757 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92319	100.0	RAN-binding pro...	Homo sapiens
AAY24132	100.0	unknown [Homo s...	Homo sapiens
Q53T03	100.0	RanBP2-like and...	Homo sapiens
XP_001722331	99.3	RANBP2-like and...	Homo sapiens
Q99666	99.4	RanBP2-like and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000156	40	161	PF00638	Ran Binding Protein 1
	IPR000156	337	458	PF00638	Ran Binding Protein 1
	IPR000237	697	742	PF01465	GRIP
HMMSmart	IPR000156	29	158	SM00160	Ran Binding Protein 1
	IPR000156	326	455	SM00160	Ran Binding Protein 1
	IPR000237	697	744	SM00755	GRIP
ProfileScan	IPR000156	28	164	PS50196	Ran Binding Protein 1
	IPR000156	325	461	PS50196	Ran Binding Protein 1
	IPR000237	694	744	PS50913	GRIP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp