Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07691
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209422
Product ID ORK07691
Clone name pg00724
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AP2A2
cDNA sequence DNA sequence (6370 bp)
Predicted protein sequence (143 aa)
Description Homo sapiens mRNA for adaptor-related protein complex 2, alpha 2 subunit variant protein.
Features of the cloned cDNA sequence

Length: 6370 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5936 bp
Genome contig ID gi51511727f_862102
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCGTGGGCGACAGAGCGAGACTCCGTCTC
Flanking genome sequence
(115554 - 115603)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATTTCAGAGTTGGAAGAGCCCAGTTGAGGTTGGCCA

Features of the protein sequence

Length: 143 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92659 5.8e-58 100.0 adaptor-related...
Homo sapiens
EAX02417 7.4e-51 99.2 adaptor-related...
Homo sapiens
BAG50999 9.1e-51 99.2 unnamed protein...
Homo sapiens
EAX02419 1.4e-50 99.2 adaptor-related...
Homo sapiens
BAB55435 1.5e-50 99.2 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002553 1 128 PF01602 Clathrin/coatomer adaptor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp