ORK07694

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07694

Order Kazusa clone(s) from :

Accession No	AB209428
Product ID	ORK07694
Clone name	ph00555
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PAK2
cDNA sequence	DNA sequence (5139 bp) Predicted protein sequence (279 aa)
Description	Homo sapiens mRNA for p21-activated kinase 2 variant protein.

Features of the cloned cDNA sequence

Description

Length: 5139 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	939 bp
Genome contig ID	gi51511731r_19088997
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCTTCAATTTGGAAATAAATTTCTGTATATGTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTAGGTTTATTTTTGTTCTTTTTGTTTTTCATTAATCCTCTCTCAC

Features of the protein sequence

Description

Length: 279 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92665	3.1e-109	100.0	p21-activated k...	Homo sapiens
XP_001099837	1.3e-99	92.4	p21-activated k...	Macaca mulatta
Q13177	1.3e-99	92.4	Serine/threonin...	Homo sapiens
BAF84028	1.3e-99	92.4	unnamed protein...	Homo sapiens
Q29502	1.3e-99	92.4	Serine/threonin...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	11	248	PD000001	Protein kinase
HMMPfam	IPR000719	7	255	PF00069	Protein kinase
HMMSmart	IPR001245	7	253	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	7	255	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	7	255	PS50011	Protein kinase
ScanRegExp	IPR000719	13	36	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp