ORK07698

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07698

Order Kazusa clone(s) from :

Accession No	AB209629
Product ID	ORK07698
Clone name	sh02887
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO7A
cDNA sequence	DNA sequence (5740 bp) Predicted protein sequence (843 aa)
Description	Homo sapiens mRNA for myosin VIIA variant protein.

Features of the cloned cDNA sequence

Description

Length: 5740 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1517 bp
Genome contig ID	gi51511727f_76468519
PolyA signal sequence (CATAAA,-23)	+--------+--------+----*----+---- ATCACCTCAGGGCATAAAGCATGTTTCATTCTCTG
Flanking genome sequence (135414 - 135463)	----+--------+--------+--------+--------+----* GCCCGACAGTGTCTTTGCTCAGGGAGGGGAAGTGGAAGGGAAGGGCATGT

Features of the protein sequence

Description

Length: 843 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92866	100.0	myosin VIIA var...	Homo sapiens
BAG06735	100.0	MYO7A variant p...	Homo sapiens
AAC50927	99.5	myosin VIIa [Ho...	Homo sapiens
NP_001120652	99.5	myosin-VIIa iso...	Homo sapiens
EAW75022	99.4	myosin VIIA, is...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001452	222	285	PF00018	Src homology-3
HMMPfam	IPR000857	405	511	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
HMMSmart	IPR001452	222	286	SM00326	Src homology-3
	IPR000857	362	511	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	513	730	SM00295	Band 4.1
ProfileScan	IPR001452	219	287	PS50002	Src homology-3
	IPR000857	362	511	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	517	843	PS50057	Band 4.1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp