Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07705
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226154
Product ID ORK07705
Clone name sj03213
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DUS1L
cDNA sequence DNA sequence (4478 bp)
Predicted protein sequence (229 aa)
Description Homo sapiens mRNA for PP3111 protein variant, clone: sj03213.
Features of the cloned cDNA sequence

Length: 4478 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3483 bp
Genome contig ID gi51511734r_77509045
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGTGCAAAAGTGAACAATAAATCATTTCAAAGATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGAGAGCCCACAGCCTGTGACCACTGCCCTCTCAGACCCAGGGAGGCATG

Features of the protein sequence

Length: 229 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW89743 5.3e-41 80.3 dihydrouridine ...
Homo sapiens
AAI26847 3e-31 75.1 Dihydrouridine ...
Bos taurus
BAG60579 7.9e-31 98.0 unnamed protein...
Homo sapiens
EAW89744 8.7e-31 98.0 dihydrouridine ...
Homo sapiens
AAH17081 1e-30 97.0 DUS1L protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001269 2 229 PF01207 Dihydrouridine synthase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp