Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07712
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290171
Product ID ORK07712
Clone name sj08895y2
Vector information
The cDNA fragment was inserted at ApaI-NotI site of the pBlu ...
Symbol DNHD1
cDNA sequence DNA sequence (11562 bp)
Predicted protein sequence (3841 aa)
Description Homo sapiens mRNA for DNHD1 variant protein
Features of the cloned cDNA sequence

Length: 11562 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 36 bp
Genome contig ID gi51511727f_6411730
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CCCGTCTACCAAAATAAAGTTGTAGTGATTCCATG
Flanking genome sequence
(138100 - 138149)
----+----*----+----*----+----*----+----*----+----*
AAAGATTTCTGAGATATGGGGGTAGAGTAGGGTGTGTGCACACCAAGAAG

Features of the protein sequence

Length: 3841 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG06725 0 100.0 DNHD1 variant p...
Homo sapiens
XP_874544 0 72.4 similar to DNHD...
Bos taurus
XP_001075408 0 70.0 similar to Dyne...
Rattus norvegicus
EDL16804 0 66.9 mCG141377 [Mus ...
Mus musculus
EDM18014 0 66.7 rCG39998 [Rattu...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013602 90 555 PF08393 Dynein heavy chain
IPR004273 3060 3838 PF03028 Dynein heavy chain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp