ORK07766

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07766

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07766
Clone name	bm09321
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HEY1
cDNA sequence	DNA sequence (2243 bp) Predicted protein sequence (347 aa)
HaloTag ORF Clone	FHC07766
Flexi ORF Clone	FXC07766
Description	hairy/enhancer-of-split related with YRPW motif 1

Features of the cloned cDNA sequence

Description

Length: 2243 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1172 bp
Genome contig ID	gi51511724r_80738806
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACTGATGTGTTGTGACTAAATAAAAAAGAAAGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTATTCTGTGGTGTATGTCTTACATACCTTGGCCTTTCCCCCTCTTG

Features of the protein sequence

Description

Length: 347 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH24133	3.8e-108	100.0	hairy/enhancer-...	synthetic construct
Q9Y5J3	7.3e-108	99.6	Hairy/enhancer-...	Homo sapiens
AAV38865	7.3e-108	99.6	hairy/enhancer-...	synthetic construct
BAG51980	1.2e-107	99.3	unnamed protein...	Homo sapiens
AAX43038	1.3e-107	99.3	hairy/enhancer-...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	95	148	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMPfam	IPR003650	164	210	PF07527	Orange
HMMSmart	IPR001092	98	153	SM00353	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR003650	163	210	SM00511	Orange
ProfileScan	IPR001092	93	148	PS50888	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR003650	165	201	PS51054	Orange

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp