Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07771
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07771
Clone name hg02934s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF292
cDNA sequence DNA sequence (8782 bp)
Predicted protein sequence (2298 aa)
Description zinc finger protein 292
Features of the cloned cDNA sequence

Length: 8782 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1885 bp
Genome contig ID gi89161210f_87921342
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TATTTATTAAAATAAAAGTTATTTTATGGGTGATT
Flanking genome sequence
(108783 - 108832)
----+----*----+----*----+----*----+----*----+----*
AATACATGGGTTTTCTTTTTCCTAAATTAACAATAATTTAAATAACTGAG

Features of the protein sequence

Length: 2298 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAH73308 0 99.9 zinc finger pro...
Homo sapiens
EAW48608 0 99.9 hCG1640214, iso...
Homo sapiens
EAW48607 0 99.9 hCG1640214, iso...
Homo sapiens
XP_518625 0 99.5 zinc finger pro...
Pan troglodytes
XP_001088554 0 97.6 zinc finger pro...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 144 166 PF00096 Zinc finger
IPR007087 256 280 PF00096 Zinc finger
IPR007087 382 406 PF00096 Zinc finger
IPR007087 673 698 PF00096 Zinc finger
IPR007087 1522 1547 PF00096 Zinc finger
IPR007087 1831 1856 PF00096 Zinc finger
HMMSmart IPR015880 117 138 SM00355 Zinc finger
IPR015880 144 166 SM00355 Zinc finger
IPR015880 256 280 SM00355 Zinc finger
IPR015880 297 319 SM00355 Zinc finger
IPR015880 325 349 SM00355 Zinc finger
IPR015880 354 378 SM00355 Zinc finger
IPR015880 382 406 SM00355 Zinc finger
IPR015880 673 698 SM00355 Zinc finger
IPR015880 950 970 SM00355 Zinc finger
IPR015880 1477 1502 SM00355 Zinc finger
IPR015880 1522 1547 SM00355 Zinc finger
IPR015880 1689 1714 SM00355 Zinc finger
IPR015880 1747 1772 SM00355 Zinc finger
IPR015880 1791 1816 SM00355 Zinc finger
IPR015880 1831 1856 SM00355 Zinc finger
IPR015880 1961 1985 SM00355 Zinc finger
ProfileScan IPR007087 144 171 PS50157 Zinc finger
IPR007087 256 285 PS50157 Zinc finger
IPR007087 297 324 PS50157 Zinc finger
IPR007087 325 354 PS50157 Zinc finger
IPR007087 382 411 PS50157 Zinc finger
IPR007087 673 703 PS50157 Zinc finger
IPR007087 950 977 PS50157 Zinc finger
IPR007087 1522 1547 PS50157 Zinc finger
IPR007087 1689 1719 PS50157 Zinc finger
IPR007087 1747 1777 PS50157 Zinc finger
IPR007087 1831 1861 PS50157 Zinc finger
ScanRegExp IPR007087 146 166 PS00028 Zinc finger
IPR007087 258 280 PS00028 Zinc finger
IPR007087 299 319 PS00028 Zinc finger
IPR007087 327 349 PS00028 Zinc finger
IPR007087 356 378 PS00028 Zinc finger
IPR007087 384 406 PS00028 Zinc finger
IPR007087 675 698 PS00028 Zinc finger
IPR007087 1524 1548 PS00028 Zinc finger
IPR007087 1691 1714 PS00028 Zinc finger
IPR007087 1749 1772 PS00028 Zinc finger
IPR007087 1793 1816 PS00028 Zinc finger
IPR007087 1833 1856 PS00028 Zinc finger
IPR007087 1963 1985 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp