Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07772
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07772
Clone name hh14180
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OGT
cDNA sequence DNA sequence (5421 bp)
Predicted protein sequence (1090 aa)
Flexi ORF Clone FXC07772
Description O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
Features of the cloned cDNA sequence

Length: 5421 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2095 bp
Genome contig ID gi89161218f_70569660
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
TCTTGCGATCCTTAATAAATGAATGATTTCCCTTT
Flanking genome sequence
(142807 - 142856)		 
----+----*----+----*----+----*----+----*----+----*
AATACGGCTGATGTATTTTGTATCCTGTTATATTGAGTGTTGGACTGAAG

Features of the protein sequence

Length: 1090 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH14434 0 100.0 O-linked N-acet...
 Homo sapiens
XP_001493438 0 99.9 O-linked N-acet...
 Equus caballus
AAI40543 0 99.8 OGT protein [Bo...
 Bos taurus
XP_538075 0 99.7 similar to O-li...
 Canis lupus fam...
EDL95887 0 99.5 O-linked N-acet...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 133 166 PF00515 Tetratricopeptide TPR_1
IPR001440 167 200 PF00515 Tetratricopeptide TPR_1
IPR001440 201 234 PF00515 Tetratricopeptide TPR_1
IPR001440 235 268 PF00515 Tetratricopeptide TPR_1
IPR001440 269 302 PF00515 Tetratricopeptide TPR_1
IPR001440 303 336 PF00515 Tetratricopeptide TPR_1
IPR001440 337 370 PF00515 Tetratricopeptide TPR_1
IPR001440 371 404 PF00515 Tetratricopeptide TPR_1
IPR001440 405 438 PF00515 Tetratricopeptide TPR_1
IPR001440 439 472 PF00515 Tetratricopeptide TPR_1
IPR001440 473 506 PF00515 Tetratricopeptide TPR_1
HMMSmart IPR013026 65 98 SM00028 Tetratricopeptide region
IPR013026 133 166 SM00028 Tetratricopeptide region
IPR013026 167 200 SM00028 Tetratricopeptide region
IPR013026 201 234 SM00028 Tetratricopeptide region
IPR013026 235 268 SM00028 Tetratricopeptide region
IPR013026 269 302 SM00028 Tetratricopeptide region
IPR013026 303 336 SM00028 Tetratricopeptide region
IPR013026 337 370 SM00028 Tetratricopeptide region
IPR013026 371 404 SM00028 Tetratricopeptide region
IPR013026 405 438 SM00028 Tetratricopeptide region
IPR013026 439 472 SM00028 Tetratricopeptide region
IPR013026 473 506 SM00028 Tetratricopeptide region
ProfileScan IPR013026 65 98 PS50005 Tetratricopeptide region
IPR013026 65 540 PS50293 Tetratricopeptide region
IPR013026 133 166 PS50005 Tetratricopeptide region
IPR013026 167 200 PS50005 Tetratricopeptide region
IPR013026 201 234 PS50005 Tetratricopeptide region
IPR013026 235 268 PS50005 Tetratricopeptide region
IPR013026 269 302 PS50005 Tetratricopeptide region
IPR013026 303 336 PS50005 Tetratricopeptide region
IPR013026 337 370 PS50005 Tetratricopeptide region
IPR013026 371 404 PS50005 Tetratricopeptide region
IPR013026 405 438 PS50005 Tetratricopeptide region
IPR013026 439 472 PS50005 Tetratricopeptide region
IPR013026 473 506 PS50005 Tetratricopeptide region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp