ORK07773

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07773

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07773
Clone name	fk02085
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MSH2
cDNA sequence	DNA sequence (3101 bp) Predicted protein sequence (938 aa)
HaloTag ORF Clone	FHC07773
Flexi ORF Clone	FXC07773
Description	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)

Features of the cloned cDNA sequence

Description

Length: 3101 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	272 bp
Genome contig ID	gi89161199f_47383811
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCTGAATTTTATAAATAAAATCATGTAGTTTGTGG
Flanking genome sequence (180055 - 180104)	----+--------+--------+--------+--------+----* AATTTGAGATGCATTGTAGTTCTTCGCAGTGTGACTTCAAATATTTTGGA

Features of the protein sequence

Description

Length: 938 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P43246	100.0	DNA mismatch re...	Homo sapiens
2O8E	99.8	5'-D(GPAPAP...	Homo sapiens
Q5XXB5	99.2	DNA mismatch re...	Chlorocebus aet...
XP_538482	96.1	similar to DNA ...	Canis lupus fam...
Q3MHE4	95.3	DNA mismatch re...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000432	716	805	PD001263	DNA mismatch repair protein MutS
HMMPfam	IPR007695	21	136	PF01624	DNA mismatch repair protein MutS
	IPR007860	147	294	PF05188	MutS II
	IPR007696	301	618	PF05192	MutS III
	IPR007861	477	573	PF05190	MutS IV
	IPR000432	623	858	PF00488	DNA mismatch repair protein MutS
HMMSmart	IPR007696	325	649	SM00533	MutS III
HMMSmart	IPR000432	666	853	SM00534	DNA mismatch repair protein MutS
ScanRegExp	IPR000432	747	763	PS00486	DNA mismatch repair protein MutS

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp