ORK07774

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07774

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07774
Clone name	hm00122
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NFKB1
cDNA sequence	DNA sequence (3546 bp) Predicted protein sequence (987 aa)
HaloTag ORF Clone	FHC07774
Flexi ORF Clone	FXC07774
Description	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1

Features of the cloned cDNA sequence

Description

Length: 3546 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	504 bp
Genome contig ID	gi89161207f_103541850
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGCTTTTTCTAATGTGGTTATTTCTCTGATTTGC
Flanking genome sequence (215453 - 215502)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATACTTGTCAATATTTAAACATGGTTACA

Features of the protein sequence

Description

Length: 987 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001168657	100.0	similar to kapp...	Pan troglodytes
XP_001168701	99.8	nuclear factor ...	Pan troglodytes
P19838	100.0	Nuclear factor ...	Homo sapiens
AAA36360	99.8	nuclear factor ...	Homo sapiens
AAH51765	99.8	Nuclear factor ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000451	67	84	PR00057	NF-kappa-B/Rel/dorsal
	IPR000451	250	264	PR00057	NF-kappa-B/Rel/dorsal
	IPR000451	283	303	PR00057	NF-kappa-B/Rel/dorsal
	IPR000451	319	337	PR00057	NF-kappa-B/Rel/dorsal
	IPR000451	360	374	PR00057	NF-kappa-B/Rel/dorsal
	IPR002110	634	646	PR01415	Ankyrin
	IPR002110	646	658	PR01415	Ankyrin
HMMPfam	IPR011539	63	261	PF00554	Rel homology
	IPR002909	269	368	PF01833	Cell surface receptor IPT/TIG
	IPR002110	561	583	PF00023	Ankyrin
	IPR002110	600	632	PF00023	Ankyrin
	IPR002110	633	665	PF00023	Ankyrin
	IPR002110	669	701	PF00023	Ankyrin
	IPR002110	703	736	PF00023	Ankyrin
	IPR002110	737	769	PF00023	Ankyrin
	IPR000488	836	911	PF00531	Death
HMMSmart	IPR002909	268	369	SM00429	Cell surface receptor IPT/TIG
	IPR002110	561	591	SM00248	Ankyrin
	IPR002110	600	629	SM00248	Ankyrin
	IPR002110	633	662	SM00248	Ankyrin
	IPR002110	669	698	SM00248	Ankyrin
	IPR002110	703	733	SM00248	Ankyrin
	IPR002110	737	766	SM00248	Ankyrin
	IPR000488	824	911	SM00005	Death
ProfileScan	IPR011539	58	265	PS50254	Rel homology
	IPR002110	561	769	PS50297	Ankyrin
	IPR002110	600	632	PS50088	Ankyrin
	IPR002110	633	665	PS50088	Ankyrin
	IPR002110	669	701	PS50088	Ankyrin
	IPR002110	703	736	PS50088	Ankyrin
	IPR002110	737	769	PS50088	Ankyrin
ScanRegExp	IPR000451	76	82	PS01204	NF-kappa-B/Rel/dorsal

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp