Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07775
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07775
Clone name fk11832
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol XRCC5
cDNA sequence DNA sequence (3350 bp)
Predicted protein sequence (756 aa)
Flexi ORF Clone FXC07775
Description X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Features of the cloned cDNA sequence

Length: 3350 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1078 bp
Genome contig ID gi89161199f_216582332
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTTTGTACATGTAACATTAAAGGCATAAATGACTC
Flanking genome sequence
(196918 - 196967)
----+----*----+----*----+----*----+----*----+----*
ATCTCTCTGTGAATTGCTGCTAATTATTGTCTGCAAAAGACTTCTTCAGT

Features of the protein sequence

Length: 756 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW70563 0 100.0 X-ray repair co...
Homo sapiens
XP_001151933 0 99.7 ATP-dependent D...
Pan troglodytes
P13010 0 100.0 ATP-dependent D...
Homo sapiens
BAD96323 0 99.7 ATP-dependent D...
Homo sapiens
BAF83429 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005161 33 268 PF03731 Ku70/Ku80
IPR006164 275 484 PF02735 DNA helicase
IPR005160 499 595 PF03730 Ku70/Ku80 C-terminal arm
IPR014893 614 733 PF08785 Ku
HMMSmart IPR002035 31 273 SM00327 von Willebrand factor
IPR006164 326 465 SM00559 DNA helicase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp