ORK07776

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07776

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07776
Clone name	fk12438
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZHX1
cDNA sequence	DNA sequence (3580 bp) Predicted protein sequence (880 aa)
HaloTag ORF Clone	FHC07776
Flexi ORF Clone	FXC07776
Description	zinc fingers and homeoboxes 1

Features of the cloned cDNA sequence

Description

Length: 3580 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	464 bp
Genome contig ID	gi51511724r_124231281
PolyA signal sequence (AGTAAA,-23)	+--------+--------+----*----+---- CAAAAATTTTACAGTAAAAATTGTTAGAAATGGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAACCCTGATTTATTACTATGTCTTATTTAT

Features of the protein sequence

Description

Length: 880 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKY1	100.0	Zinc fingers an...	Homo sapiens
A1YG99	99.7	Zinc fingers an...	Pan paniscus
A1YF22	99.5	Zinc fingers an...	Gorilla gorilla...
BAF82221	99.7	unnamed protein...	Homo sapiens
AAH40481	99.7	Zinc fingers an...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001356	475	528	PF00046	Homeobox
HMMPfam	IPR001356	670	724	PF00046	Homeobox
HMMSmart	IPR015880	77	100	SM00355	Zinc finger
	IPR015880	109	132	SM00355	Zinc finger
	IPR001356	291	353	SM00389	Homeobox
	IPR001356	471	533	SM00389	Homeobox
	IPR001356	576	637	SM00389	Homeobox
	IPR001356	667	729	SM00389	Homeobox
	IPR001356	784	839	SM00389	Homeobox
ProfileScan	IPR007087	109	137	PS50157	Zinc finger
	IPR001356	306	349	PS50071	Homeobox
	IPR001356	475	529	PS50071	Homeobox
	IPR001356	583	633	PS50071	Homeobox
	IPR001356	675	725	PS50071	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp