ORK08910

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK08910

Order Kazusa clone(s) from :

Accession No
Product ID	ORK08910
Clone name	bm03069
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RTKN
cDNA sequence	DNA sequence (2263 bp) Predicted protein sequence (582 aa)
HaloTag ORF Clone	FHC08910
Flexi ORF Clone	FXC08910
Description	rhotekin

Features of the cloned cDNA sequence

Description

Length: 2263 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	362 bp
Genome contig ID	gi89161199r_74406516
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TCCCACATCAACCATTAAAGTTATTTAACAGCAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCACCTGGCTCCTGAGGACAGGGTGCCTCTCTCTGCCTGGTCTAGACC

Features of the protein sequence

Description

Length: 582 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH17727	6.1e-214	100.0	Rhotekin [Homo ...	Homo sapiens
XP_515558	1.1e-212	99.4	rhotekin isofor...	Pan troglodytes
Q9BST9	2.7e-205	100.0	Rhotekin.	Homo sapiens
XP_001157465	4.8e-204	99.4	rhotekin isofor...	Pan troglodytes
AAL16767	2.8e-202	98.4	RTKN [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000861	55	127	PF02185	HR1-like rho-binding repeat
HMMPfam	IPR001849	329	430	PF00169	Pleckstrin-like
HMMSmart	IPR011072	55	118	SM00742	HR1 rho-binding repeat
HMMSmart	IPR001849	329	437	SM00233	Pleckstrin-like
ProfileScan	IPR001849	328	435	PS50003	Pleckstrin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp