ORK09010

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK09010

Order Kazusa clone(s) from :

Accession No
Product ID	ORK09010
Clone name	ej01176
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	KPNA6
cDNA sequence	DNA sequence (3933 bp) Predicted protein sequence (541 aa)
HaloTag ORF Clone	FHC09010
Flexi ORF Clone	FXC09010
Description	karyopherin alpha 6 (importin alpha 7)

Features of the cloned cDNA sequence

Description

Length: 3933 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2279 bp
Genome contig ID	gi89161185f_32246276
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GCTACCTCCATTAAAAAACCATTCTCTTACAGTTT
Flanking genome sequence (165087 - 165136)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGCCTTCCCCTACCCAACCTCCGCCCATTG

Features of the protein sequence

Description

Length: 541 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60684	100.0	Importin subuni...	Homo sapiens
XP_001102290	100.0	karyopherin alp...	Macaca mulatta
BAG63185	99.8	unnamed protein...	Homo sapiens
XP_864794	99.8	similar to Impo...	Canis lupus fam...
BAE01108	99.8	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002652	10	99	PF01749	Importin-alpha-like
	IPR000225	117	159	PF00514	Armadillo
	IPR000225	161	201	PF00514	Armadillo
	IPR000225	203	244	PF00514	Armadillo
	IPR000225	246	286	PF00514	Armadillo
	IPR000225	288	328	PF00514	Armadillo
	IPR000225	330	370	PF00514	Armadillo
	IPR000225	372	412	PF00514	Armadillo
	IPR000225	415	455	PF00514	Armadillo
HMMSmart	IPR000225	117	159	SM00185	Armadillo
	IPR000225	161	201	SM00185	Armadillo
	IPR000225	202	244	SM00185	Armadillo
	IPR000225	247	286	SM00185	Armadillo
	IPR000225	288	328	SM00185	Armadillo
	IPR000225	330	370	SM00185	Armadillo
	IPR000225	372	412	SM00185	Armadillo
	IPR000225	415	455	SM00185	Armadillo
ProfileScan	IPR002652	2	65	PS51214	Importin-alpha-like
	IPR000225	129	172	PS50176	Armadillo
	IPR000225	172	200	PS50176	Armadillo
	IPR000225	341	372	PS50176	Armadillo

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp