Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK09679
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK09679
Clone name hk04481
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF711
cDNA sequence DNA sequence (4488 bp)
Predicted protein sequence (765 aa)
Description zinc finger protein 711
Features of the cloned cDNA sequence

Length: 4488 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1532 bp
Genome contig ID gi89161218f_84288565
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
AAATGAGCATACAATAAAAAGCATTTATTGCACTT
Flanking genome sequence
(126459 - 126508)		 
----+----*----+----*----+----*----+----*----+----*
AATGGTTTTATAAGTTTATTTAAAGTTTCCATATTTTTTATTAAAAGACT

Features of the protein sequence

Length: 765 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH67294 0 100.0 Zinc finger pro...
 Homo sapiens
XP_228451 0 97.3 similar to zinc...
 Rattus norvegicus
XP_604385 0 97.6 similar to zinc...
 Bos taurus
XP_549113 0 97.5 similar to zinc...
 Canis lupus fam...
CAM21380 0 96.4 zinc finger pro...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 509 532 PD000003 Zinc finger
HMMPfam IPR006794 68 372 PF04704 Zfx / Zfy transcription activation region
IPR007087 387 409 PF00096 Zinc finger
IPR007087 418 440 PF00096 Zinc finger
IPR007087 480 503 PF00096 Zinc finger
IPR007087 509 531 PF00096 Zinc finger
IPR007087 537 560 PF00096 Zinc finger
IPR007087 566 591 PF00096 Zinc finger
IPR007087 594 617 PF00096 Zinc finger
IPR007087 623 645 PF00096 Zinc finger
IPR007087 680 702 PF00096 Zinc finger
IPR007087 708 731 PF00096 Zinc finger
IPR007087 737 759 PF00096 Zinc finger
HMMSmart IPR015880 387 409 SM00355 Zinc finger
IPR015880 418 440 SM00355 Zinc finger
IPR015880 480 503 SM00355 Zinc finger
IPR015880 509 531 SM00355 Zinc finger
IPR015880 537 560 SM00355 Zinc finger
IPR015880 566 591 SM00355 Zinc finger
IPR015880 594 617 SM00355 Zinc finger
IPR015880 623 645 SM00355 Zinc finger
IPR015880 651 674 SM00355 Zinc finger
IPR015880 680 702 SM00355 Zinc finger
IPR015880 708 731 SM00355 Zinc finger
IPR015880 737 759 SM00355 Zinc finger
ProfileScan IPR007087 387 417 PS50157 Zinc finger
IPR007087 480 508 PS50157 Zinc finger
IPR007087 509 536 PS50157 Zinc finger
IPR007087 537 565 PS50157 Zinc finger
IPR007087 566 593 PS50157 Zinc finger
IPR007087 594 622 PS50157 Zinc finger
IPR007087 623 650 PS50157 Zinc finger
IPR007087 651 679 PS50157 Zinc finger
IPR007087 680 707 PS50157 Zinc finger
IPR007087 708 736 PS50157 Zinc finger
IPR007087 737 764 PS50157 Zinc finger
ScanRegExp IPR007087 389 409 PS00028 Zinc finger
IPR007087 511 531 PS00028 Zinc finger
IPR007087 539 560 PS00028 Zinc finger
IPR007087 625 645 PS00028 Zinc finger
IPR007087 682 702 PS00028 Zinc finger
IPR007087 739 760 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp