ORK09683

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK09683

Order Kazusa clone(s) from :

Accession No
Product ID	ORK09683
Clone name	pj00909s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA C-5' end of cDNA.
Symbol	EGFR
cDNA sequence	DNA sequence (3914 bp) Predicted protein sequence (1210 aa)
HaloTag ORF Clone	FHC09683
Flexi ORF Clone	FXC09683
Description	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)

Features of the cloned cDNA sequence

Description

Length: 3914 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	281 bp
Genome contig ID	gi89161213f_54954465
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAGCAGAAATTTATCTTTCAAAGAGGTATATTTG
Flanking genome sequence (286622 - 286671)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGTATATGTGAGGATTTTTATTGATTGGGGATCTTGGA

Features of the protein sequence

Description

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P00533	99.9	Epidermal growt...	Homo sapiens
AAX41033	99.9	epidermal growt...	synthetic construct
AAZ66620	99.8	cell proliferat...	Homo sapiens
CAA25240	99.8	epidermal growt...	Homo sapiens
AAT52212	99.8	cell growth inh...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	716	975	PD000001	Protein kinase
FPrintScan	IPR001245	790	803	PR00109	Tyrosine protein kinase
	IPR001245	827	845	PR00109	Tyrosine protein kinase
	IPR001245	876	886	PR00109	Tyrosine protein kinase
	IPR001245	895	917	PR00109	Tyrosine protein kinase
	IPR001245	939	961	PR00109	Tyrosine protein kinase
HMMPfam	IPR000494	57	168	PF01030	EGF receptor
	IPR006211	184	338	PF00757	Furin-like cysteine rich region
	IPR000494	361	481	PF01030	EGF receptor
	IPR001245	712	968	PF07714	Tyrosine protein kinase
HMMSmart	IPR006212	228	270	SM00261	Furin-like repeat
	IPR006212	496	547	SM00261	Furin-like repeat
	IPR006212	552	601	SM00261	Furin-like repeat
	IPR001245	712	968	SM00219	Tyrosine protein kinase
	IPR002290	712	969	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	712	979	PS50011	Protein kinase
ScanRegExp	IPR000719	718	745	PS00107	Protein kinase
ScanRegExp	IPR008266	833	845	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	AGAALLALLAALCPASRALEE	27	SECONDARY	21
SOSUI2	2	646	IATGMVGALLLLLVVALGIGLFM	668	PRIMARY	23