ORK09906

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK09906

Order Kazusa clone(s) from :

Accession No
Product ID	ORK09906
Clone name	ek00155
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PLAT
cDNA sequence	DNA sequence (2528 bp) Predicted protein sequence (589 aa)
HaloTag ORF Clone	FHC09906
Flexi ORF Clone	FXC09906
Description	plasminogen activator, tissue

Features of the cloned cDNA sequence

Description

Length: 2528 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	756 bp
Genome contig ID	gi51511724r_42051912
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- TTAATAAATTCAGATATATTTTTCACAGTTTTTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCAGAGTGGAATGGTTTTGTTATAGATGCTGTATCCCACTCTTTAT

Features of the protein sequence

Description

Length: 589 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_528120	99.6	plasminogen act...	Pan troglodytes
P00750	100.0	Tissue-type pla...	Homo sapiens
AAP36181	100.0	plasminogen act...	synthetic construct
AAO34406	99.8	tissue plasmino...	Homo sapiens
AAH95403	99.8	Plasminogen act...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000001	156	238	PD000395	Kringle
BlastProDom	IPR000001	245	324	PD000395	Kringle
FPrintScan	IPR000001	242	257	PR00018	Kringle
	IPR000001	258	270	PR00018	Kringle
	IPR000001	287	307	PR00018	Kringle
	IPR000001	312	323	PR00018	Kringle
	IPR001314	370	385	PR00722	Peptidase S1A
	IPR001314	429	443	PR00722	Peptidase S1A
	IPR001314	533	545	PR00722	Peptidase S1A
HMMPfam	IPR000083	68	105	PF00039	Fibronectin
	IPR006209	113	146	PF00008	EGF-like
	IPR000001	154	235	PF00051	Kringle
	IPR000001	242	323	PF00051	Kringle
	IPR001254	338	583	PF00089	Peptidase S1 and S6
HMMSmart	IPR000083	68	110	SM00058	Fibronectin
	IPR000001	152	237	SM00130	Kringle
	IPR000001	240	325	SM00130	Kringle
	IPR001254	337	583	SM00020	Peptidase S1 and S6
ProfileScan	IPR000083	66	108	PS51091	Fibronectin
	IPR000742	109	147	PS50026	EGF-like
	IPR000001	153	235	PS50070	Kringle
	IPR000001	241	323	PS50070	Kringle
	IPR001254	338	588	PS50240	Peptidase S1 and S6
ScanRegExp	IPR000083	68	105	PS01253	Fibronectin
	IPR013032	135	146	PS00022	EGF-like region
	IPR013032	135	146	PS01186	EGF-like region
	IPR000001	205	217	PS00021	Kringle
	IPR000001	293	305	PS00021	Kringle
	IPR001254	380	385	PS00134	Peptidase S1 and S6
	IPR001254	534	545	PS00135	Peptidase S1 and S6

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	34	GLCCVLLLCGAVFVSPSQEI	53	PRIMARY	20