ORK10375

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10375

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10375
Clone name	ag00172s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA C-5' end of cDNA.
Symbol	MAP2K1
cDNA sequence	DNA sequence (2089 bp) Predicted protein sequence (393 aa)
HaloTag ORF Clone	FHC10375
Flexi ORF Clone	FXC10375
Description	Dual specificity mitogen-activated protein kinase kinase 1 (MAP kinase kinase 1)(MAPKK 1)(EC 2.7.12.2)(ERK activator kinase 1)(MAPK/ERK kinase 1)(MEK1)

Features of the cloned cDNA sequence

Description

Length: 2089 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	907 bp
Genome contig ID	gi51511731f_64366740
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCTAATCTCTTATTCTAATAAATATACTATGAAAT
Flanking genome sequence (204176 - 204225)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGATGAAAGCTACTTTTGCTTTTGTGGTAAGCTTTTCAGT

Features of the protein sequence

Description

Length: 393 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q02750	4.5e-147	100.0	Dual specificit...	Homo sapiens
XP_001110225	1e-146	99.7	mitogen-activat...	Macaca mulatta
P29678	1.4e-146	99.7	Dual specificit...	Oryctolagus cun...
Q01986	2.7e-146	99.2	Dual specificit...	Rattus norvegicus
EAW77767	4.7e-146	99.7	mitogen-activat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	68	271	PD000001	Protein kinase
HMMPfam	IPR000719	68	361	PF00069	Protein kinase
HMMSmart	IPR001245	68	360	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	68	361	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	68	361	PS50011	Protein kinase
ScanRegExp	IPR000719	74	97	PS00107	Protein kinase
ScanRegExp	IPR008271	186	198	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp