Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10378
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10378
Clone name bm02056
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NDE1
cDNA sequence DNA sequence (1950 bp)
Predicted protein sequence (354 aa)
Description Nuclear distribution protein nudE homolog 1 (NudE)
Features of the cloned cDNA sequence

Length: 1950 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 883 bp
Genome contig ID gi51511732f_15566093
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTGAGAAAATACCCGTGAGGTATGGGACTCTGAT
Flanking genome sequence
(160401 - 160450)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACACACACACACACAAAAAAAACAGAATCTGTGGCT

Features of the protein sequence

Length: 354 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA90949 1.3e-98 100.0 unnamed protein...
Homo sapiens
AAH33900 2.7e-98 99.7 NDE1 protein [H...
Homo sapiens
BAE89549 5.3e-98 99.4 unnamed protein...
Macaca fascicularis
XP_001109585 5.7e-93 96.1 similar to nucl...
Macaca mulatta
Q9NXR1 1.4e-92 96.0 Nuclear distrib...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006964 153 352 PF04880 NUDE protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp