Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10388
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10388
Clone name bm05720
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ENOPH1
cDNA sequence DNA sequence (1918 bp)
Predicted protein sequence (316 aa)
Flexi ORF Clone FXC10388
Description Enolase-phosphatase E1 (EC 3.1.3.77)(2,3-diketo-5-methylthio-1-phosphopentane phosphatase)(MASA homolog)
Features of the cloned cDNA sequence

Length: 1918 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 966 bp
Genome contig ID gi89161207f_83470841
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTCATGTTGTGATTAATAAAAGCATTTTTTCTTC
Flanking genome sequence
(130424 - 130473)
----+----*----+----*----+----*----+----*----+----*
ACTCAGTTTTATATAGGTTCCTGAACTCTATCCACATGCCGCCATAGCAA

Features of the protein sequence

Length: 316 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UHY7 1e-91 100.0 Enolase-phospha...
Homo sapiens
BAE91285 3.9e-91 99.6 unnamed protein...
Macaca fascicularis
XP_001094685 6.8e-90 98.4 similar to E-1 ...
Macaca mulatta
1ZS9 6e-89 98.0 E-1 ENZYME
Homo sapiens
EDL20306 1e-87 83.2 RIKEN cDNA 2310...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005834 65 288 PF00702 Haloacid dehalogenase-like hydrolase
HMMTigr IPR010041 65 310 TIGR01691 2
IPR006439 145 279 TIGR01549 HAD-superfamily hydrolase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp