Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10394
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10394
Clone name bn02188
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PDRG1
cDNA sequence DNA sequence (1285 bp)
Predicted protein sequence (147 aa)
Flexi ORF Clone FXC10394
Description p53 and DNA damage-regulated protein 1
Features of the cloned cDNA sequence

Length: 1285 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 841 bp
Genome contig ID gi51511747r_29896430
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGTTCATTAAGGGCTCAATAAATGTTAGCTGAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGAATAGCAGCAACTAGTCTTTATTTGCCTCATCTAGTCCTTCAGTAA

Features of the protein sequence

Length: 147 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_534380 2.6e-46 91.8 similar to p53 ...
Canis lupus fam...
Q9NUG6 7.2e-46 100.0 p53 and DNA dam...
Homo sapiens
Q5RFA9 1.7e-45 98.4 p53 and DNA dam...
Pongo abelii
XP_001498397 3.6e-45 97.7 similar to p53 ...
Equus caballus
AAH01856 3.6e-44 100.0 PDRG1 protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 40 134 PD296328 NULL
HMMPfam IPR002777 76 122 PF01920 Prefoldin beta-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp