ORK10395

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10395

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10395
Clone name	bm04118
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	EIF3E
cDNA sequence	DNA sequence (1515 bp) Predicted protein sequence (445 aa)
HaloTag ORF Clone	FHC10395
Flexi ORF Clone	FXC10395
Description	Eukaryotic translation initiation factor 3 subunit E (eIF3e)(Eukaryotic translation initiation factor 3 subunit 6)(eIF-3 p48)(Viral integration site protein INT-6 homolog)

Features of the cloned cDNA sequence

Description

Length: 1515 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	175 bp
Genome contig ID	gi51511724r_109183148
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAGAAGAGCCTGCTTTCTTGTACAAAGTGGTGA
Flanking genome sequence (246962 - 246913)	----+--------+--------+--------+--------+----* TTATTAGTTTTCGACCATGACTTAGGACAGGCAGCCCATTTTTCTCCCTA

Features of the protein sequence

Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P60228	2.6e-191	100.0	Eukaryotic tran...	Homo sapiens
AAX29771	2.6e-191	100.0	eukaryotic tran...	synthetic construct
AAH17887	5.6e-191	99.7	Eukaryotic tran...	Homo sapiens
Q3T102	5.6e-191	99.7	Eukaryotic tran...	Bos taurus
AAX36482	7.7e-191	99.7	eukaryotic tran...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000717	290	395	PF01399	Proteasome component region PCI
HMMSmart	IPR000717	327	411	SM00088	Proteasome component region PCI

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp