ORK10401

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10401

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10401
Clone name	ff03389
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RNF19A
cDNA sequence	DNA sequence (4212 bp) Predicted protein sequence (838 aa)
Description	E3 ubiquitin-protein ligase RNF19A (EC 6.3.2.-)(RING finger protein 19A)(Double ring-finger protein)(Dorfin)(p38)

Features of the cloned cDNA sequence

Description

Length: 4212 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1488 bp
Genome contig ID	gi51511724r_101238472
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACTGCATACGTTAAATAAATGTAAATACTAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCTGCCTTCTGGTGTGTACACAAGTGTTTTTTTTTAATAAGAATGAG

Features of the protein sequence

Description

Length: 838 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NV58	100.0	E3 ubiquitin-pr...	Homo sapiens
BAB39353	99.8	ring-IBR-ring d...	Homo sapiens
XP_848454	97.8	similar to ring...	Canis lupus fam...
XP_001789408	97.8	similar to ring...	Bos taurus
Q2VJ60	97.3	E3 ubiquitin-pr...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	132	179	PF00097	Zinc finger
HMMPfam	IPR002867	199	264	PF01485	Zinc finger
HMMSmart	IPR001841	132	179	SM00184	Zinc finger
	IPR002867	199	264	SM00647	Zinc finger
	IPR002867	283	347	SM00647	Zinc finger
ProfileScan	IPR001841	132	180	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	368	LVGAPVGIALIAGIAIPAMIIGI	390	PRIMARY	23
SOSUI2	2	424	VIVSPVVAAVTVGIGVPIMLAYV	446	PRIMARY	23