ORK10415

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10415

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10415
Clone name	fj03263
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was inserted at the NotI site of the vector. The 3' end of the cDNA was ligated with the SalI adapter (5'CGGACGCGTG GGTCGA3') and inserted at the SalI site of the vector.
Symbol	WWC1
cDNA sequence	DNA sequence (4167 bp) Predicted protein sequence (1141 aa)
HaloTag ORF Clone	FHC10415
Flexi ORF Clone	FXC10415
Description

Features of the cloned cDNA sequence

Description

Length: 4167 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	740 bp
Genome contig ID	gi51511721f_167551651
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTATCTCCATCAATAAAGTGGCCTTTCAAAAAG
Flanking genome sequence (277691 - 277740)	----+--------+--------+--------+--------+----* AATCTTCCTCTTGCTCTCTTTTTCTTTCCTACCCCTCACTTCATCTGTTT

Features of the protein sequence

Description

Length: 1141 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IX03	100.0	Protein WWC1; W...	Homo sapiens
BAG59017	99.4	unnamed protein...	Homo sapiens
CAH90075	99.0	hypothetical pr...	Pongo abelii
XP_001091174	96.4	similar to KIBR...	Macaca mulatta
CAE45903	99.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	36	65	PF00397	WW/Rsp5/WWP
HMMPfam	IPR001202	83	112	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	35	67	SM00456	WW/Rsp5/WWP
HMMSmart	IPR001202	82	114	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	34	67	PS50020	WW/Rsp5/WWP
ProfileScan	IPR001202	81	114	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	40	65	PS01159	WW/Rsp5/WWP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp