ORK10423

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10423

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10423
Clone name	ha01834
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	RPL23
cDNA sequence	DNA sequence (466 bp) Predicted protein sequence (140 aa)
HaloTag ORF Clone	FHC10423
Flexi ORF Clone	FXC10423
Description	60S ribosomal protein L23 (Ribosomal protein L17)

Features of the cloned cDNA sequence

Description

Length: 466 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	41 bp
Genome contig ID	gi51511734r_34159894
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGTATATTTGTAAAAAATAAAAAAAAACTAAACCC
Flanking genome sequence (99974 - 99925)	----+--------+--------+--------+--------+----* ATTAAAAAGTATTTGTTTGCAGTGCTTGTCTCCCTGTTCACTTCCAGGGT

Features of the protein sequence

Description

Length: 140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q90YU5	2.8e-56	100.0	60S ribosomal p...	Ictalurus punctatus
XP_001509789	3.6e-56	100.0	hypothetical pr...	Ornithorhynchus...
Q6PC14	5.3e-56	99.2	60S ribosomal p...	Danio rerio
AAH73541	6.2e-56	99.2	MGC82808 protei...	Xenopus laevis
BAB28415	6.2e-56	99.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000218	19	139	PD001093	Ribosomal protein L14b/L23e
HMMPfam	IPR000218	19	140	PF00238	Ribosomal protein L14b/L23e
ScanRegExp	IPR000218	79	105	PS00049	Ribosomal protein L14b/L23e

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp