ORK10427

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10427

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10427
Clone name	hg02529
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ICOSLG
cDNA sequence	DNA sequence (6218 bp) Predicted protein sequence (350 aa)
HaloTag ORF Clone	FHC10427
Flexi ORF Clone	FXC10427
Description	ICOS ligand Precursor (B7 homolog 2)(B7-H2)(B7-like protein Gl50)(B7-related protein 1)(B7RP-1)(CD275 antigen)

Features of the cloned cDNA sequence

Description

Length: 6218 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5163 bp
Genome contig ID	gi51511750r_44368633
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTCCAGCCTGGGAACAAGAGCGAAACTCTGACT
Flanking genome sequence (216642 - 216593)	----+--------+--------+--------+--------+----* CTGGATCCATCCGTGTGAGACATGCAAGAAACCTGCAAAGGTACAATAGT

Features of the protein sequence

Description

Length: 350 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75144	1e-121	100.0	ICOS ligand; B7...	Homo sapiens
EAX09447	1.3e-120	100.0	inducible T-cel...	Homo sapiens
AAF34739	3.2e-120	100.0	B7-like protein...	Homo sapiens
XP_531578	2.1e-118	98.3	similar to B7-l...	Pan troglodytes
BAH11654	1.6e-85	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	63	179	PF07686	Immunoglobulin V-set
HMMSmart	IPR003599	70	183	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	42	177	PS50835	Immunoglobulin-like
ProfileScan	IPR007110	189	275	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	303	ATWSILAVLCLLVVVAVAIGWVC	325	PRIMARY	23