ORK10434

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10434

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10434
Clone name	pf04566
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ATM
cDNA sequence	DNA sequence (6824 bp) Predicted protein sequence (2100 aa)
Description	Serine-protein kinase ATM (EC 2.7.11.1)(Ataxia telangiectasia mutated)(A-T, mutated)

Features of the cloned cDNA sequence

Description

Length: 6824 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	521 bp
Genome contig ID	gi51511727f_107547031
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGTGACAAGAGCGAAACTCCGTCTC
Flanking genome sequence (194937 - 194986)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAACAGAAACGTATTTGGATTTTTCCTAGTAAGA

Features of the protein sequence

Description

Length: 2100 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAB65827	100.0	ATM [Homo sapiens].	Homo sapiens
XP_945884	99.9	similar to Seri...	Homo sapiens
2124355A	99.9	ATM gene.	Homo sapiens
Q13315	99.9	Serine-protein ...	Homo sapiens
AAB38309	99.9	ataxia-telangie...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003151	1140	1535	PF02259	PIK-related kinase
	IPR000403	1755	2006	PF00454	Phosphatidylinositol 3- and 4-kinase
	IPR003152	2068	2100	PF02260	PIK-related kinase
HMMSmart	IPR000403	1757	2060	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR014009	1004	1610	PS51189	PIK-related kinase
	IPR000403	1756	2100	PS50290	Phosphatidylinositol 3- and 4-kinase
	IPR003152	2068	2100	PS51190	PIK-related kinase
ScanRegExp	IPR000403	1760	1774	PS00915	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	1899	1919	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp