ORK10439

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10439

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10439
Clone name	sh02014
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNMBP
cDNA sequence	DNA sequence (5413 bp) Predicted protein sequence (1277 aa)
Description	Dynamin-binding protein (Scaffold protein Tuba)

Features of the cloned cDNA sequence

Description

Length: 5413 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1577 bp
Genome contig ID	gi89161187r_101525324
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTAGTTCTTTTATAAATAAAAGCATTTCTAATGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTGGATGTTTTCTTGATTTCCATGTTTAAGCTGAACGGGTTTTTTTGTT

Features of the protein sequence

Description

Length: 1277 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6XZF7	100.0	Dynamin-binding...	Homo sapiens
XP_001167601	99.0	dynamin binding...	Pan troglodytes
EAW49850	99.9	dynamin binding...	Homo sapiens
XP_001106775	95.3	similar to dyna...	Macaca mulatta
XP_001500703	82.7	dynamin binding...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	1220	1271	PD000066	Src homology-3
FPrintScan	IPR001452	1002	1017	PR00452	Src homology-3
FPrintScan	IPR001452	1262	1274	PR00452	Src homology-3
HMMPfam	IPR000219	488	666	PF00621	DH
	IPR004148	697	907	PF03114	BAR
	IPR011511	989	1046	PF07653	Variant SH3
	IPR001452	1216	1274	PF00018	Src homology-3
HMMSmart	IPR000219	488	666	SM00325	DH
	IPR004148	696	910	SM00721	BAR
	IPR001452	988	1047	SM00326	Src homology-3
	IPR001452	1216	1275	SM00326	Src homology-3
ProfileScan	IPR000219	484	667	PS50010	DH
	IPR004148	708	917	PS51021	BAR
	IPR001452	1213	1276	PS50002	Src homology-3
ScanRegExp	IPR001331	615	640	PS00741	Guanine-nucleotide dissociation stimulator

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp