Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10443
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10443
Clone name fj00071s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF398
cDNA sequence DNA sequence (5199 bp)
Predicted protein sequence (729 aa)
Flexi ORF Clone FXC10443
Description zinc finger protein 398
Features of the cloned cDNA sequence

Length: 5199 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2987 bp
Genome contig ID gi89161213f_148375485
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTGTGAAAATAAATGGAAGTTGGTTGATTGTCTAG
Flanking genome sequence
(135335 - 135384)
----+----*----+----*----+----*----+----*----+----*
AAAGTGCAAGAAGATGGCCCTGCTCCTTTTCTGCTGAACATTTAGTATTG

Features of the protein sequence

Length: 729 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8TD17 0 100.0 Zinc finger pro...
Homo sapiens
BAF83188 0 99.8 unnamed protein...
Homo sapiens
XP_001166485 0 99.8 zinc finger 398...
Pan troglodytes
BAG63321 0 98.7 unnamed protein...
Homo sapiens
EAW80060 0 100.0 zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 598 621 PD000003 Zinc finger
IPR007087 626 649 PD000003 Zinc finger
HMMPfam IPR001909 230 270 PF01352 KRAB box
IPR007087 485 507 PF00096 Zinc finger
IPR007087 514 536 PF00096 Zinc finger
IPR007087 542 564 PF00096 Zinc finger
IPR007087 570 592 PF00096 Zinc finger
IPR007087 598 620 PF00096 Zinc finger
IPR007087 626 648 PF00096 Zinc finger
IPR007087 654 677 PF00096 Zinc finger
HMMSmart IPR001909 230 290 SM00349 KRAB box
IPR015880 430 451 SM00355 Zinc finger
IPR015880 485 507 SM00355 Zinc finger
IPR015880 514 536 SM00355 Zinc finger
IPR015880 542 564 SM00355 Zinc finger
IPR015880 570 592 SM00355 Zinc finger
IPR015880 598 620 SM00355 Zinc finger
IPR015880 626 648 SM00355 Zinc finger
IPR015880 654 677 SM00355 Zinc finger
ProfileScan IPR003655 227 291 PS50806 KRAB-related
IPR001909 230 301 PS50805 KRAB box
IPR007087 457 484 PS50157 Zinc finger
IPR007087 485 512 PS50157 Zinc finger
IPR007087 514 541 PS50157 Zinc finger
IPR007087 542 569 PS50157 Zinc finger
IPR007087 570 597 PS50157 Zinc finger
IPR007087 598 625 PS50157 Zinc finger
IPR007087 626 653 PS50157 Zinc finger
IPR007087 654 679 PS50157 Zinc finger
ScanRegExp IPR007087 487 507 PS00028 Zinc finger
IPR007087 516 536 PS00028 Zinc finger
IPR007087 544 564 PS00028 Zinc finger
IPR007087 572 592 PS00028 Zinc finger
IPR007087 600 620 PS00028 Zinc finger
IPR007087 628 648 PS00028 Zinc finger
IPR007087 656 677 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp