ORK10444

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10444

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10444
Clone name	fj03968
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARHGAP23
cDNA sequence	DNA sequence (3720 bp) Predicted protein sequence (1165 aa)
HaloTag ORF Clone	FHC10444
Flexi ORF Clone	FXC10444
Description	Rho GTPase activating protein 23

Features of the cloned cDNA sequence

Description

Length: 3720 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	220 bp
Genome contig ID	gi51511734f_33729041
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTGGGGCGGGGGCCACAGCGCCGGGGACTCAGGA
Flanking genome sequence (190851 - 190900)	----+--------+--------+--------+--------+----* GCGGCCGCAGGGGCCGCTGCCTGGCGCCGTCGCCCCCGAGGCCCCCGGAC

Features of the protein sequence

Description

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P227	99.7	Rho GTPase-acti...	Homo sapiens
Q69ZH9	93.5	Rho GTPase-acti...	Mus musculus
CAM15702	93.1	Rho GTPase acti...	Mus musculus
NP_065927	100.0	Rho GTPase acti...	Homo sapiens
XP_601322	94.3	similar to Rho ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	94	173	PF00595	PDZ/DHR/GLGF
	IPR001849	710	829	PF00169	Pleckstrin-like
	IPR000198	941	1094	PF00620	RhoGAP
HMMSmart	IPR001478	73	176	SM00228	PDZ/DHR/GLGF
	IPR001849	710	831	SM00233	Pleckstrin-like
	IPR000198	938	1115	SM00324	RhoGAP
ProfileScan	IPR001478	92	176	PS50106	PDZ/DHR/GLGF
	IPR001849	709	829	PS50003	Pleckstrin-like
	IPR000198	926	1118	PS50238	RhoGAP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp