Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10457
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10457
Clone name fk03085
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TRIM24
cDNA sequence DNA sequence (3465 bp)
Predicted protein sequence (1094 aa)
Flexi ORF Clone FXC10457
Description tripartite motif-containing 24
Features of the cloned cDNA sequence

Length: 3465 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 179 bp
Genome contig ID gi89161213f_137695701
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TAATAGCCCATTTCTGTTAACCTCTTATCACTAAG
Flanking genome sequence
(224716 - 224765)		 
----+----*----+----*----+----*----+----*----+----*
AAAGAAAGGAAAGAAGGAGATGAATAGAAGAAAGAAAATGGAAAGAAGGA

Features of the protein sequence

Length: 1094 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15164 0 100.0 Transcription i...
 Homo sapiens
XP_001107279 0 99.7 transcriptional...
 Macaca mulatta
Q64127 0 93.2 Transcription i...
 Mus musculus
EDM15345 0 93.2 rCG27932, isofo...
 Rattus norvegicus
BAG63911 0 100.0 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000315 276 293 PR01406 Zinc finger
IPR000315 294 308 PR01406 Zinc finger
IPR001487 976 992 PR00503 Bromodomain
IPR001487 1012 1031 PR00503 Bromodomain
HMMPfam IPR001841 100 174 PF00097 Zinc finger
IPR000315 202 249 PF00643 Zinc finger
IPR000315 262 303 PF00643 Zinc finger
IPR001965 872 917 PF00628 Zinc finger
IPR001487 945 1036 PF00439 Bromodomain
HMMSmart IPR001841 100 174 SM00184 Zinc finger
IPR000315 202 249 SM00336 Zinc finger
IPR000315 262 303 SM00336 Zinc finger
IPR003649 310 436 SM00502 B-box
IPR001965 872 915 SM00249 Zinc finger
IPR001487 945 1050 SM00297 Bromodomain
ProfileScan IPR001841 100 175 PS50089 Zinc finger
IPR000315 202 255 PS50119 Zinc finger
IPR000315 262 303 PS50119 Zinc finger
IPR001965 870 917 PS50016 Zinc finger
IPR001487 976 1031 PS50014 Bromodomain
ScanRegExp IPR001841 117 126 PS00518 Zinc finger
IPR001965 873 914 PS01359 Zinc finger
IPR001487 962 1023 PS00633 Bromodomain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp