Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10459
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10459
Clone name fh13114
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAGI1
cDNA sequence DNA sequence (5110 bp)
Predicted protein sequence (1260 aa)
Flexi ORF Clone FXC10459
Description membrane associated guanylate kinase, WW and PDZ domain containing 1
Features of the cloned cDNA sequence

Length: 5110 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 780 bp
Genome contig ID gi89161205r_65221084
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TATGTCCTATTTATTTGAGATTTGTGTTTAAAATT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAAGAAGCTATGCCCTAGATGTAGGGCTTTTTT

Features of the protein sequence

Length: 1260 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI67863 0 99.8 Membrane associ...
 synthetic construct
BAA32002 0 99.7 BAI1-associated...
 Homo sapiens
BAF82492 0 99.6 unnamed protein...
 Homo sapiens
XP_001091141 0 98.5 similar to memb...
 Macaca mulatta
Q96QZ7 0 98.7 Membrane-associ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR008144 148 243 PF00625 Guanylate kinase
IPR001202 305 334 PF00397 WW/Rsp5/WWP
IPR001202 364 393 PF00397 WW/Rsp5/WWP
IPR001478 476 542 PF00595 PDZ/DHR/GLGF
IPR001478 647 724 PF00595 PDZ/DHR/GLGF
IPR001478 845 926 PF00595 PDZ/DHR/GLGF
IPR001478 1002 1095 PF00595 PDZ/DHR/GLGF
IPR001478 1156 1235 PF00595 PDZ/DHR/GLGF
HMMSmart IPR001478 28 107 SM00228 PDZ/DHR/GLGF
IPR008145 113 298 SM00072 Guanylate kinase/L-type calcium channel region
IPR001202 304 336 SM00456 WW/Rsp5/WWP
IPR001202 363 395 SM00456 WW/Rsp5/WWP
IPR001478 484 560 SM00228 PDZ/DHR/GLGF
IPR001478 655 727 SM00228 PDZ/DHR/GLGF
IPR001478 853 929 SM00228 PDZ/DHR/GLGF
IPR001478 1011 1098 SM00228 PDZ/DHR/GLGF
IPR001478 1164 1238 SM00228 PDZ/DHR/GLGF
ProfileScan IPR001478 19 107 PS50106 PDZ/DHR/GLGF
IPR008144 98 191 PS50052 Guanylate kinase
IPR001202 303 336 PS50020 WW/Rsp5/WWP
IPR001202 362 395 PS50020 WW/Rsp5/WWP
IPR001478 476 545 PS50106 PDZ/DHR/GLGF
IPR001478 647 725 PS50106 PDZ/DHR/GLGF
IPR001478 845 927 PS50106 PDZ/DHR/GLGF
IPR001478 1002 1098 PS50106 PDZ/DHR/GLGF
IPR001478 1156 1238 PS50106 PDZ/DHR/GLGF
ScanRegExp IPR008144 147 164 PS00856 Guanylate kinase
IPR001202 309 334 PS01159 WW/Rsp5/WWP
IPR001202 368 393 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp