ORK10464

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10464

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10464
Clone name	pj01509
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BRF1
cDNA sequence	DNA sequence (3752 bp) Predicted protein sequence (691 aa)
HaloTag ORF Clone	FHC10464
Flexi ORF Clone	FXC10464
Description	zinc finger protein 36, C3H type-like 1

Features of the cloned cDNA sequence

Description

Length: 3752 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1257 bp
Genome contig ID	gi51511730r_104646676
PolyA signal sequence (AGTAAA,-28)	+--------+--------+----*----+---- TAGATTTAGTAAAGCAGGAAGATCTGTTGTTACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAGAAATTGCCTGAGGCTTGTCTGATTCTGTGTTGCGATCTGTGGCCA

Features of the protein sequence

Description

Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92994	100.0	Transcription f...	Homo sapiens
XP_510208	99.5	transcription i...	Pan troglodytes
EDL18569	89.8	BRF1 homolog, s...	Mus musculus
Q8CFK2	89.6	Transcription f...	Mus musculus
AAC50170	90.4	TFIIIB 90 kDa s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000812	32	52	PR00685	Transcription factor TFIIB related
	IPR000812	147	166	PR00685	Transcription factor TFIIB related
	IPR000812	173	188	PR00685	Transcription factor TFIIB related
	IPR000812	237	253	PR00685	Transcription factor TFIIB related
	IPR000812	269	283	PR00685	Transcription factor TFIIB related
HMMPfam	IPR013137	18	60	PF08271	Zinc finger
	IPR013150	107	177	PF00382	Transcription factor TFIIB
	IPR013150	201	274	PF00382	Transcription factor TFIIB
	IPR011665	462	561	PF07741	Brf1-like TBP-binding
HMMSmart	IPR006670	105	186	SM00385	Cyclin
HMMSmart	IPR006670	199	283	SM00385	Cyclin
ProfileScan	IPR013137	16	47	PS51134	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp