Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10470
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10470
Clone name fj00169
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF226
cDNA sequence DNA sequence (4927 bp)
Predicted protein sequence (814 aa)
Flexi ORF Clone FXC10470
Description zinc finger protein 226
Features of the cloned cDNA sequence

Length: 4927 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2412 bp
Genome contig ID gi42406306f_49261747
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ACTCTAGCCTGGGTGACAGAGCAAGACTCTGTCTC
Flanking genome sequence
(114334 - 114383)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAACCCAAGAAGGTGAGGGCAAATTCAG

Features of the protein sequence

Length: 814 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NYT6 0 100.0 Zinc finger pro...
 Homo sapiens
BAG37139 0 99.8 unnamed protein...
 Homo sapiens
AAF34786 0 99.8 zinc finger pro...
 Homo sapiens
AAF88103 0 99.8 zinc finger pro...
 Homo sapiens
XP_001108650 0 96.2 zinc finger pro...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 319 340 PD000003 Zinc finger
IPR007087 346 369 PD000003 Zinc finger
IPR007087 374 397 PD000003 Zinc finger
IPR007087 402 425 PD000003 Zinc finger
IPR007087 430 453 PD000003 Zinc finger
IPR007087 458 481 PD000003 Zinc finger
IPR007087 486 509 PD000003 Zinc finger
IPR007087 514 537 PD000003 Zinc finger
IPR007087 542 565 PD000003 Zinc finger
IPR007087 570 593 PD000003 Zinc finger
IPR007087 598 621 PD000003 Zinc finger
IPR007087 626 649 PD000003 Zinc finger
IPR007087 654 677 PD000003 Zinc finger
IPR007087 682 705 PD000003 Zinc finger
IPR007087 710 733 PD000003 Zinc finger
IPR007087 738 761 PD000003 Zinc finger
IPR007087 766 788 PD000003 Zinc finger
HMMPfam IPR001909 19 59 PF01352 KRAB box
IPR007087 318 340 PF00096 Zinc finger
IPR007087 346 368 PF00096 Zinc finger
IPR007087 374 396 PF00096 Zinc finger
IPR007087 402 424 PF00096 Zinc finger
IPR007087 430 452 PF00096 Zinc finger
IPR007087 458 480 PF00096 Zinc finger
IPR007087 486 508 PF00096 Zinc finger
IPR007087 514 536 PF00096 Zinc finger
IPR007087 542 564 PF00096 Zinc finger
IPR007087 570 592 PF00096 Zinc finger
IPR007087 598 620 PF00096 Zinc finger
IPR007087 626 648 PF00096 Zinc finger
IPR007087 654 676 PF00096 Zinc finger
IPR007087 682 704 PF00096 Zinc finger
IPR007087 710 732 PF00096 Zinc finger
IPR007087 738 760 PF00096 Zinc finger
IPR007087 766 788 PF00096 Zinc finger
HMMSmart IPR001909 19 78 SM00349 KRAB box
IPR015880 263 283 SM00355 Zinc finger
IPR015880 291 313 SM00355 Zinc finger
IPR015880 318 340 SM00355 Zinc finger
IPR015880 346 368 SM00355 Zinc finger
IPR015880 374 396 SM00355 Zinc finger
IPR015880 402 424 SM00355 Zinc finger
IPR015880 430 452 SM00355 Zinc finger
IPR015880 458 480 SM00355 Zinc finger
IPR015880 486 508 SM00355 Zinc finger
IPR015880 514 536 SM00355 Zinc finger
IPR015880 542 564 SM00355 Zinc finger
IPR015880 570 592 SM00355 Zinc finger
IPR015880 598 620 SM00355 Zinc finger
IPR015880 626 648 SM00355 Zinc finger
IPR015880 654 676 SM00355 Zinc finger
IPR015880 682 704 SM00355 Zinc finger
IPR015880 710 732 SM00355 Zinc finger
IPR015880 738 760 SM00355 Zinc finger
IPR015880 766 788 SM00355 Zinc finger
ProfileScan IPR001909 19 89 PS50805 KRAB box
IPR007087 263 290 PS50157 Zinc finger
IPR007087 291 318 PS50157 Zinc finger
IPR007087 318 345 PS50157 Zinc finger
IPR007087 346 373 PS50157 Zinc finger
IPR007087 374 401 PS50157 Zinc finger
IPR007087 402 429 PS50157 Zinc finger
IPR007087 430 457 PS50157 Zinc finger
IPR007087 458 485 PS50157 Zinc finger
IPR007087 486 513 PS50157 Zinc finger
IPR007087 514 541 PS50157 Zinc finger
IPR007087 542 569 PS50157 Zinc finger
IPR007087 570 597 PS50157 Zinc finger
IPR007087 598 625 PS50157 Zinc finger
IPR007087 626 653 PS50157 Zinc finger
IPR007087 654 681 PS50157 Zinc finger
IPR007087 682 709 PS50157 Zinc finger
IPR007087 710 737 PS50157 Zinc finger
IPR007087 738 765 PS50157 Zinc finger
IPR007087 766 793 PS50157 Zinc finger
ScanRegExp IPR007087 320 340 PS00028 Zinc finger
IPR007087 348 368 PS00028 Zinc finger
IPR007087 376 396 PS00028 Zinc finger
IPR007087 404 424 PS00028 Zinc finger
IPR007087 432 452 PS00028 Zinc finger
IPR007087 460 480 PS00028 Zinc finger
IPR007087 488 508 PS00028 Zinc finger
IPR007087 516 536 PS00028 Zinc finger
IPR007087 544 564 PS00028 Zinc finger
IPR007087 572 592 PS00028 Zinc finger
IPR007087 600 620 PS00028 Zinc finger
IPR007087 628 648 PS00028 Zinc finger
IPR007087 656 676 PS00028 Zinc finger
IPR007087 684 704 PS00028 Zinc finger
IPR007087 712 732 PS00028 Zinc finger
IPR007087 740 760 PS00028 Zinc finger
IPR007087 768 788 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp