ORK10478

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10478

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10478
Clone name	aj01304
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FGFR3
cDNA sequence	DNA sequence (4295 bp) Predicted protein sequence (895 aa)
HaloTag ORF Clone	FHC10478
Flexi ORF Clone	FXC10478
Description	fibroblast growth factor receptor 3

Features of the cloned cDNA sequence

Description

Length: 4295 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1607 bp
Genome contig ID	gi89161207f_1664826
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TTTCCGAAAAATAAAGACACCTGGTTGCTAACCTG
Flanking genome sequence (115572 - 115621)	----+--------+--------+--------+--------+----* GCCCTGTGCTTTCTGTCTCCAGTTCTGGGATAGGGGAGGGAGGGGTCACT

Features of the protein sequence

Description

Length: 895 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P22607	99.8	Fibroblast grow...	Homo sapiens
XP_001101108	99.0	fibroblast grow...	Macaca mulatta
AAM22078	99.8	fibroblast grow...	Homo sapiens
EAW82562	95.6	fibroblast grow...	Homo sapiens
EDL37433	92.5	fibroblast grow...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	567	841	PD000001	Protein kinase
FPrintScan	IPR001245	644	657	PR00109	Tyrosine protein kinase
	IPR001245	696	714	PR00109	Tyrosine protein kinase
	IPR001245	745	755	PR00109	Tyrosine protein kinase
	IPR001245	764	786	PR00109	Tyrosine protein kinase
	IPR001245	808	830	PR00109	Tyrosine protein kinase
HMMPfam	IPR013151	143	200	PF00047	Immunoglobulin
	IPR013098	246	334	PF07679	Immunoglobulin I-set
	IPR013151	357	430	PF00047	Immunoglobulin
	IPR001245	561	837	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	135	215	SM00409	Immunoglobulin subtype
	IPR003598	141	205	SM00408	Immunoglobulin subtype 2
	IPR003599	250	335	SM00409	Immunoglobulin subtype
	IPR003598	256	324	SM00408	Immunoglobulin subtype 2
	IPR003599	349	446	SM00409	Immunoglobulin subtype
	IPR003598	355	435	SM00408	Immunoglobulin subtype 2
	IPR001245	561	837	SM00219	Tyrosine protein kinase
	IPR002290	561	841	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	128	199	PS50835	Immunoglobulin-like
	IPR007110	240	333	PS50835	Immunoglobulin-like
	IPR007110	342	444	PS50835	Immunoglobulin-like
	IPR000719	561	850	PS50011	Protein kinase
ScanRegExp	IPR000719	567	597	PS00107	Protein kinase
ScanRegExp	IPR008266	702	714	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	92	APACALALCVAVAIVAGASSE	112	PRIMARY	21
SOSUI2	2	463	AGILSYGVGFFLFILVVAAVTLC	485	PRIMARY	23