ORK10479

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10479

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10479
Clone name	pj01967
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CSF1R
cDNA sequence	DNA sequence (3855 bp) Predicted protein sequence (1026 aa)
HaloTag ORF Clone	FHC10479
Flexi ORF Clone	FXC10479
Description	colony stimulating factor 1 receptor

Features of the cloned cDNA sequence

Description

Length: 3855 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	773 bp
Genome contig ID	gi51511721r_149313052
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TGTCTCTGTCCACATTAAACTAACAGCATTGATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCAGCCTCTGGTTCTTTGTGCCACATGAGTACCTGCAAATTCCCTGGA

Features of the protein sequence

Description

Length: 1026 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P07333	100.0	Macrophage colo...	Homo sapiens
CAA27300	99.8	unnamed protein...	Homo sapiens
AAH47521	99.6	Colony stimulat...	Homo sapiens
XP_001107833	95.6	similar to colo...	Macaca mulatta
AAX40993	99.6	colony stimulat...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	642	732	PD000001	Protein kinase
BlastProDom	IPR000719	802	959	PD000001	Protein kinase
HMMPfam	IPR013106	73	156	PF07686	Immunoglobulin V-set
	IPR013151	271	334	PF00047	Immunoglobulin
	IPR013151	466	541	PF00047	Immunoglobulin
	IPR001245	636	964	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	81	156	SM00409	Immunoglobulin subtype
	IPR003599	166	250	SM00409	Immunoglobulin subtype
	IPR003599	263	350	SM00409	Immunoglobulin subtype
	IPR003598	269	339	SM00408	Immunoglobulin subtype 2
	IPR003599	362	453	SM00409	Immunoglobulin subtype
	IPR003599	458	558	SM00409	Immunoglobulin subtype
	IPR003598	464	546	SM00408	Immunoglobulin subtype 2
	IPR001245	636	964	SM00219	Tyrosine protein kinase
	IPR002290	636	964	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	75	139	PS50835	Immunoglobulin-like
	IPR007110	257	344	PS50835	Immunoglobulin-like
	IPR007110	456	556	PS50835	Immunoglobulin-like
	IPR000719	636	964	PS50011	Protein kinase
ScanRegExp	IPR000719	642	670	PS00107	Protein kinase
	IPR001824	695	708	PS00240	Receptor tyrosine kinase
	IPR008266	828	840	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	569	FTPVVVACMSIMALLLLLLLLLL	591	PRIMARY	23