ORK10480

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10480

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10480
Clone name	fk06583
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CTTN
cDNA sequence	DNA sequence (3233 bp) Predicted protein sequence (560 aa)
HaloTag ORF Clone	FHC10480
Flexi ORF Clone	FXC10480
Description	cortactin

Features of the cloned cDNA sequence

Description

Length: 3233 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1411 bp
Genome contig ID	gi51511727f_69822297
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAATTAAAGAATTCAGAATAAACATTTTTTGATCC
Flanking genome sequence (138033 - 138082)	----+--------+--------+--------+--------+----* ACTTGCGTGATTTGCTTTGGTCTGTGGTCACTCCGTTCTGCAGTGGAAGC

Features of the protein sequence

Description

Length: 560 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14247	2.5e-187	100.0	Src substrate c...	Homo sapiens
BAD96333	4.1e-187	99.8	cortactin isofo...	Homo sapiens
AAA58455	5.3e-187	99.8	amplaxin [Homo ...	Homo sapiens
EAW74770	4.8e-185	98.3	cortactin, isof...	Homo sapiens
XP_001100193	6.9e-185	98.3	similar to cort...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	506	557	PD000066	Src homology-3
FPrintScan	IPR000108	407	424	PR00499	Neutrophil cytosol factor 2
	IPR001452	505	515	PR00452	Src homology-3
	IPR000108	507	527	PR00499	Neutrophil cytosol factor 2
	IPR001452	519	534	PR00452	Src homology-3
	IPR000108	527	543	PR00499	Neutrophil cytosol factor 2
	IPR001452	536	545	PR00452	Src homology-3
	IPR000108	543	556	PR00499	Neutrophil cytosol factor 2
	IPR001452	547	559	PR00452	Src homology-3
HMMPfam	IPR003134	93	129	PF02218	Hs1/Cortactin
	IPR003134	130	166	PF02218	Hs1/Cortactin
	IPR003134	167	203	PF02218	Hs1/Cortactin
	IPR003134	204	240	PF02218	Hs1/Cortactin
	IPR003134	241	277	PF02218	Hs1/Cortactin
	IPR003134	278	314	PF02218	Hs1/Cortactin
	IPR003134	315	351	PF02218	Hs1/Cortactin
	IPR001452	505	559	PF00018	Src homology-3
HMMSmart	IPR001452	505	560	SM00326	Src homology-3
ProfileScan	IPR003134	90	126	PS51090	Hs1/Cortactin
	IPR003134	127	163	PS51090	Hs1/Cortactin
	IPR003134	164	200	PS51090	Hs1/Cortactin
	IPR003134	201	237	PS51090	Hs1/Cortactin
	IPR003134	238	274	PS51090	Hs1/Cortactin
	IPR003134	275	311	PS51090	Hs1/Cortactin
	IPR003134	312	334	PS51090	Hs1/Cortactin
	IPR001452	502	560	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp