ORK10481

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10481

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10481
Clone name	hk08893
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MPP2
cDNA sequence	DNA sequence (4305 bp) Predicted protein sequence (561 aa)
HaloTag ORF Clone	FHC10481
Flexi ORF Clone	FXC10481
Description	forkhead box M1

Features of the cloned cDNA sequence

Description

Length: 4305 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2440 bp
Genome contig ID	gi51511734r_39208257
PolyA signal sequence (ATTAAA,-15)	+--------+--------+----*----+---- TTTTCTTTCTTTTTCCTTGGATTAAATGTGAAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGCTTCTGGCTCTGCTTTTCTTTGGTTGGGGTTGGATGGATGGCTTT

Features of the protein sequence

Description

Length: 561 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH12204	4.4e-213	98.0	unnamed protein...	Homo sapiens
CAB66489	4.7e-213	98.5	hypothetical pr...	Homo sapiens
AAX29754	4.7e-213	98.5	activin A recep...	synthetic construct
BAG63996	1.3e-212	100.0	unnamed protein...	Homo sapiens
NP_005365	2e-212	98.1	palmitoylated m...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	243	298	PD000066	Src homology-3
FPrintScan	IPR001452	258	273	PR00452	Src homology-3
	IPR001452	275	284	PR00452	Src homology-3
	IPR001452	288	300	PR00452	Src homology-3
HMMPfam	IPR014775	20	75	PF02828	L27
	IPR014775	76	130	PF02828	L27
	IPR001478	149	225	PF00595	PDZ/DHR/GLGF
	IPR011511	238	300	PF07653	Variant SH3
	IPR008144	395	495	PF00625	Guanylate kinase
HMMSmart	IPR004172	20	75	SM00569	L27
	IPR004172	76	130	SM00569	L27
	IPR001478	158	228	SM00228	PDZ/DHR/GLGF
	IPR001452	237	301	SM00326	Src homology-3
	IPR008145	358	549	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR004172	17	68	PS51022	L27
	IPR004172	69	127	PS51022	L27
	IPR001478	149	228	PS50106	PDZ/DHR/GLGF
	IPR001452	234	302	PS50002	Src homology-3
	IPR008144	359	546	PS50052	Guanylate kinase
ScanRegExp	IPR008144	394	411	PS00856	Guanylate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp