Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10489
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10489
Clone name eg00560
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DYSF
cDNA sequence DNA sequence (6770 bp)
Predicted protein sequence (2165 aa)
Flexi ORF Clone FXC10489
Description dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive)
Features of the cloned cDNA sequence

Length: 6770 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 270 bp
Genome contig ID gi89161199f_71447341
PolyA signal sequence
(TATAAA,-20)
+----*----+----*----+----*----+----
TCAGACATATTTCAGTATAAAACAGTTGGAACCAC
Flanking genome sequence
(320061 - 320110)
----+----*----+----*----+----*----+----*----+----*
ACAGCAGTGTCAGTGTGTGTATCTCTACAGTACCTGAACAGGGAGTGACT

Features of the protein sequence

Length: 2165 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
ACB12763 0 100.0 dysferlin varia...
Homo sapiens
ACB12757 0 99.0 dysferlin varia...
Homo sapiens
ACB12756 0 97.5 dysferlin varia...
Homo sapiens
ACB12762 0 98.5 dysferlin varia...
Homo sapiens
ACB12754 0 96.8 dysferlin varia...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000008 1680 1692 PR00360 C2 calcium-dependent membrane targeting
IPR000008 1706 1719 PR00360 C2 calcium-dependent membrane targeting
IPR000008 1728 1736 PR00360 C2 calcium-dependent membrane targeting
HMMPfam IPR000008 48 132 PF00168 C2 calcium-dependent membrane targeting
IPR000008 300 380 PF00168 C2 calcium-dependent membrane targeting
IPR012968 381 452 PF08151 FerI
IPR000008 459 557 PF00168 C2 calcium-dependent membrane targeting
IPR012560 758 823 PF08165 FerA
IPR012561 850 925 PF08150 FerB
IPR000008 1218 1308 PF00168 C2 calcium-dependent membrane targeting
IPR000008 1402 1485 PF00168 C2 calcium-dependent membrane targeting
IPR000008 1665 1748 PF00168 C2 calcium-dependent membrane targeting
IPR000008 1989 2011 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR000008 47 147 SM00239 C2 calcium-dependent membrane targeting
IPR000008 299 395 SM00239 C2 calcium-dependent membrane targeting
IPR000008 458 572 SM00239 C2 calcium-dependent membrane targeting
IPR006613 938 997 SM00693 Dysferlin
IPR006613 1010 1066 SM00693 Dysferlin
IPR006614 1075 1113 SM00694 Dysferlin
IPR006614 1132 1165 SM00694 Dysferlin
IPR000008 1217 1325 SM00239 C2 calcium-dependent membrane targeting
IPR000008 1402 1501 SM00239 C2 calcium-dependent membrane targeting
IPR000008 1664 1763 SM00239 C2 calcium-dependent membrane targeting
IPR000008 1897 2026 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR000008 52 132 PS50004 C2 calcium-dependent membrane targeting
IPR000008 299 380 PS50004 C2 calcium-dependent membrane targeting
IPR000008 461 557 PS50004 C2 calcium-dependent membrane targeting
IPR000008 1203 1308 PS50004 C2 calcium-dependent membrane targeting
IPR000008 1650 1748 PS50004 C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 2130 WAIILFIILFILLLFLAIFIYAF 2152 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp