Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10503
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10503
Clone name bm02155
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PDIA3
cDNA sequence DNA sequence (1896 bp)
Predicted protein sequence (528 aa)
Flexi ORF Clone FXC10503
Description protein disulfide isomerase family A, member 3
Features of the cloned cDNA sequence

Length: 1896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 308 bp
Genome contig ID gi51511731f_41725960
PolyA signal sequence
(AATAAA,-7)		 
+----*----+----*----+----*----+----
ATTTTTTTTGTACATTTGGAACAGTGACAATAAAT
Flanking genome sequence
(125058 - 125107)		 
----+----*----+----*----+----*----+----*----+----*
GAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTT

Features of the protein sequence

Length: 528 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P30101 4.7e-200 100.0 Protein disulfi...
 Homo sapiens
AAP36370 4.7e-200 100.0 glucose regulat...
 synthetic construct
AAC51518 9.7e-200 99.8 ER-60 protein [...
 Homo sapiens
BAA11928 2e-199 99.6 ER-60 protease ...
 Homo sapiens
Q4VIT4 4.1e-199 99.2 Protein disulfi...
 Chlorocebus aet...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR006662 71 79 PR00421 Thioredoxin-related
IPR006662 79 88 PR00421 Thioredoxin-related
IPR006662 119 130 PR00421 Thioredoxin-related
HMMPfam IPR013766 49 154 PF00085 Thioredoxin domain
IPR013766 400 506 PF00085 Thioredoxin domain
HMMTigr IPR005792 48 528 TIGR01130 Protein disulphide isomerase
IPR005788 53 155 TIGR01126 Disulphide isomerase
IPR005788 404 507 TIGR01126 Disulphide isomerase
ScanRegExp IPR006662 72 90 PS00194 Thioredoxin-related
IPR006662 421 439 PS00194 Thioredoxin-related
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp