Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10507
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10507
Clone name bm02481
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HARS
cDNA sequence DNA sequence (1930 bp)
Predicted protein sequence (525 aa)
Flexi ORF Clone FXC10507
Description histidyl-tRNA synthetase
Features of the cloned cDNA sequence

Length: 1930 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 351 bp
Genome contig ID gi51511721r_139933675
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATTGCCAAAGGTCCAATAAAATGCCTCAACCACGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCTGCGTGTGTCAGTGATGCCTAGCCCCGCCTTCCCCAGCAGACCAAT

Features of the protein sequence

Length: 525 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P12081 1.3e-199 100.0 Histidyl-tRNA s...
Homo sapiens
Q5R4R2 7.5e-199 99.4 Histidyl-tRNA s...
Pongo abelii
AAX99363 1.5e-198 99.4 histidyl-tRNA s...
Homo sapiens
XP_001504203 1.3e-193 96.6 similar to Hist...
Equus caballus
Q2KI84 9.9e-193 96.0 Histidyl-tRNA s...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000738 23 76 PF00458 WHEP-TRS
IPR002314 88 250 PF00587 Aminoacyl-tRNA synthetase
IPR004154 426 517 PF03129 Anticodon-binding
HMMTigr IPR015807 69 514 TIGR00442 Histidyl-tRNA synthetase
ProfileScan IPR000738 19 75 PS51185 WHEP-TRS
IPR006195 53 409 PS50862 Aminoacyl-tRNA synthetase
ScanRegExp IPR000738 30 58 PS00762 WHEP-TRS
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp