ORK10511

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10511

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10511
Clone name	bm04585
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DDX19B
cDNA sequence	DNA sequence (1774 bp) Predicted protein sequence (510 aa)
HaloTag ORF Clone	FHC10511
Flexi ORF Clone	FXC10511
Description	DEAD (Asp-Glu-Ala-As) box polypeptide 19B

Features of the cloned cDNA sequence

Description

Length: 1774 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	241 bp
Genome contig ID	gi51511732f_68790609
PolyA signal sequence (AATACA,-21)	+--------+--------+----*----+---- GAAGATTAGGCATGAATACACAGAGATTTACCTTT
Flanking genome sequence (134620 - 134669)	----+--------+--------+--------+--------+----* TGGAAGTTTCATCTTTTAATTTGGCCAGTGTTTCCTTCATGCTAATCTAG

Features of the protein sequence

Description

Length: 510 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UMR2	2.2e-186	100.0	ATP-dependent R...	Homo sapiens
CAG33496	1.1e-185	99.5	DDX19 [Homo sap...	Homo sapiens
XP_001107893	1.1e-185	99.3	DEAD (Asp-Glu-A...	Macaca mulatta
BAD96835	1.2e-185	99.5	DEAD (Asp-Glu-A...	Homo sapiens
EAW51828	3.9e-185	98.9	hCG2043426, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	147	315	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	383	465	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	142	341	SM00487	DEAD-like helicases
HMMSmart	IPR001650	378	465	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	123	151	PS51195	RNA helicase
	IPR014021	156	326	PS51192	Helicase
	IPR001650	337	505	PS51194	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp