Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10515
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10515
Clone name ee22358
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RBBP5
cDNA sequence DNA sequence (3270 bp)
Predicted protein sequence (563 aa)
Flexi ORF Clone FXC10515
Description retinoblastoma binding protein 5
Features of the cloned cDNA sequence

Length: 3270 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1573 bp
Genome contig ID gi89161185r_203223246
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCTCCAGCCTAGGTGACAGAATGAGACTCTATCTC
Flanking genome sequence
(99720 - 99671)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAATGATATCAGTTGGTGGATGCTCCTATAGGTAGCC

Features of the protein sequence

Length: 563 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q15291 3.3e-206 99.8 Retinoblastoma-...
Homo sapiens
XP_848552 6.6e-206 99.6 similar to reti...
Canis lupus fam...
CAA59446 2.2e-205 99.4 RB protein bind...
Homo sapiens
EDM09795 1.3e-204 99.0 retinoblastoma ...
Rattus norvegicus
BAE32825 2.6e-204 98.8 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 55 77 PF00400 WD40 repeat
IPR001680 81 119 PF00400 WD40 repeat
HMMSmart IPR001680 39 77 SM00320 WD40 repeat
IPR001680 80 119 SM00320 WD40 repeat
IPR001680 207 251 SM00320 WD40 repeat
IPR001680 266 305 SM00320 WD40 repeat
IPR001680 308 347 SM00320 WD40 repeat
ProfileScan IPR001680 61 128 PS50294 WD40 repeat
IPR001680 87 128 PS50082 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp