Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10529
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10529
Clone name bm01881
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MXI1
cDNA sequence DNA sequence (2149 bp)
Predicted protein sequence (210 aa)
Flexi ORF Clone FXC10529
Description MAX interactor 1
Features of the cloned cDNA sequence

Length: 2149 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1504 bp
Genome contig ID gi89161187f_111877935
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATACTTTAAATAATTTAACTACCCTTAATTACTT
Flanking genome sequence
(158307 - 158356)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGCTTTATGATTTTCATAACTTATTGCTGATTTTAAT

Features of the protein sequence

Length: 210 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P50539 2.5e-74 100.0 Max-interacting...
Homo sapiens
XP_001085389 2.5e-74 100.0 similar to MAX ...
Macaca mulatta
AAA75508 3.8e-74 99.5 MXI1 [Homo sapi...
Homo sapiens
AAC50446 5.8e-74 99.5 max interactor ...
Homo sapiens
ABM82590 5.9e-74 97.1 MAX interactor ...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001092 50 102 PF00010 Basic helix-loop-helix dimerisation region bHLH
HMMSmart IPR001092 55 107 SM00353 Basic helix-loop-helix dimerisation region bHLH
ProfileScan IPR001092 50 102 PS50888 Basic helix-loop-helix dimerisation region bHLH
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp