ORK10535

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10535

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10535
Clone name	hk07181
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CBX7
cDNA sequence	DNA sequence (3983 bp) Predicted protein sequence (288 aa)
HaloTag ORF Clone	FHC10535
Flexi ORF Clone	FXC10535
Description	chromobox homolog 7

Features of the cloned cDNA sequence

Description

Length: 3983 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3116 bp
Genome contig ID	gi89161203r_37756770
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TATTAAAAATACATTAAAGATGATTTAAAAAAAAG
Flanking genome sequence (99957 - 99908)	----+--------+--------+--------+--------+----* AAAATTCCTGGGCATTTGATTATTCCTTCTGGTGGTTGTCAAGTGCATCC

Features of the protein sequence

Description

Length: 288 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95931	2.5e-87	100.0	Chromobox prote...	Homo sapiens
AAH51773	8e-87	99.2	Chromobox homol...	Homo sapiens
EAW60299	7.2e-86	96.9	chromobox homol...	Homo sapiens
XP_604126	2.5e-82	95.6	chromobox homol...	Bos taurus
XP_538368	7e-81	94.0	similar to Chro...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000953	45	53	PR00504	Chromo
	IPR000953	58	72	PR00504	Chromo
	IPR000953	73	85	PR00504	Chromo
HMMPfam	IPR000953	48	97	PF00385	Chromo
HMMSmart	IPR000953	47	99	SM00298	Chromo
ProfileScan	IPR000953	48	106	PS50013	Chromo
ScanRegExp	IPR000953	65	85	PS00598	Chromo

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp