Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10535
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10535
Clone name hk07181
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CBX7
cDNA sequence DNA sequence (3983 bp)
Predicted protein sequence (288 aa)
Flexi ORF Clone FXC10535
Description chromobox homolog 7
Features of the cloned cDNA sequence

Length: 3983 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3116 bp
Genome contig ID gi89161203r_37756770
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TATTAAAAATACATTAAAGATGATTTAAAAAAAAG
Flanking genome sequence
(99957 - 99908)
----+----*----+----*----+----*----+----*----+----*
AAAATTCCTGGGCATTTGATTATTCCTTCTGGTGGTTGTCAAGTGCATCC

Features of the protein sequence

Length: 288 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O95931 2.5e-87 100.0 Chromobox prote...
Homo sapiens
AAH51773 8e-87 99.2 Chromobox homol...
Homo sapiens
EAW60299 7.2e-86 96.9 chromobox homol...
Homo sapiens
XP_604126 2.5e-82 95.6 chromobox homol...
Bos taurus
XP_538368 7e-81 94.0 similar to Chro...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000953 45 53 PR00504 Chromo
IPR000953 58 72 PR00504 Chromo
IPR000953 73 85 PR00504 Chromo
HMMPfam IPR000953 48 97 PF00385 Chromo
HMMSmart IPR000953 47 99 SM00298 Chromo
ProfileScan IPR000953 48 106 PS50013 Chromo
ScanRegExp IPR000953 65 85 PS00598 Chromo
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp