ORK11431

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11431

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11431
Clone name	hh01319
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PEX7
cDNA sequence	DNA sequence (1460 bp) Predicted protein sequence (347 aa)
HaloTag ORF Clone	FHC11431
Flexi ORF Clone	FXC11431
Description	peroxisomal biogenesis factor 7

Features of the cloned cDNA sequence

Description

Length: 1460 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	410 bp
Genome contig ID	gi89161210f_137085419
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- GATAAATAAACTATCTATTGATCATTTATCATTTT
Flanking genome sequence (191347 - 191396)	----+--------+--------+--------+--------+----* ATAACTTCCCCCAAAAGACTGCTCTTTCTAATACATTGTATATGTGAATA

Features of the protein sequence

Description

Length: 347 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O00628	7.8e-140	100.0	Peroxisomal tar...	Homo sapiens
XP_518763	2.9e-138	99.0	peroxisomal bio...	Pan troglodytes
XP_001097630	4.3e-137	97.8	peroxisomal bio...	Macaca mulatta
XP_541117	8.3e-132	92.5	similar to Pero...	Canis lupus fam...
P97865	4.5e-129	92.6	Peroxisomal tar...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	130	165	PD000018	WD40 repeat
	IPR001680	174	209	PD000018	WD40 repeat
	IPR001680	262	295	PD000018	WD40 repeat
FPrintScan	IPR001680	107	121	PR00320	WD40 repeat
	IPR001680	152	166	PR00320	WD40 repeat
	IPR001680	195	209	PR00320	WD40 repeat
HMMPfam	IPR001680	81	120	PF00400	WD40 repeat
	IPR001680	125	165	PF00400	WD40 repeat
	IPR001680	169	208	PF00400	WD40 repeat
	IPR001680	212	251	PF00400	WD40 repeat
	IPR001680	256	295	PF00400	WD40 repeat
	IPR001680	300	339	PF00400	WD40 repeat
HMMSmart	IPR001680	81	120	SM00320	WD40 repeat
	IPR001680	124	165	SM00320	WD40 repeat
	IPR001680	168	208	SM00320	WD40 repeat
	IPR001680	211	251	SM00320	WD40 repeat
	IPR001680	255	295	SM00320	WD40 repeat
	IPR001680	299	339	SM00320	WD40 repeat
ProfileScan	IPR001680	87	347	PS50294	WD40 repeat
	IPR001680	131	174	PS50082	WD40 repeat
	IPR001680	175	210	PS50082	WD40 repeat
	IPR001680	218	254	PS50082	WD40 repeat
	IPR001680	262	304	PS50082	WD40 repeat
ScanRegExp	IPR001680	107	121	PS00678	WD40 repeat
	IPR001680	238	252	PS00678	WD40 repeat
	IPR001680	282	296	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp