Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11432
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11432
Clone name hh09742
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol COPS3
cDNA sequence DNA sequence (1645 bp)
Predicted protein sequence (457 aa)
Flexi ORF Clone FXC11432
Description COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
Features of the cloned cDNA sequence

Length: 1645 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 271 bp
Genome contig ID gi51511734r_16990866
PolyA signal sequence
(ATTAAA,-32)
+----*----+----*----+----*----+----
TGCATTAAATCTACCTTTTTGTTTTAAGTTGCTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATTAATGTGTCTTCTGTATCACTTTTTTCTCCTCTGAAGTTTTTAAT

Features of the protein sequence

Length: 457 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UNS2 5.7e-178 100.0 COP9 signalosom...
Homo sapiens
Q68FW9 6.7e-178 99.7 COP9 signalosom...
Rattus norvegicus
O88543 1.7e-177 99.5 COP9 signalosom...
Mus musculus
XP_536667 2e-177 99.7 similar to COP9...
Canis lupus fam...
XP_001362211 2.3e-177 99.5 similar to COP9...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000717 292 396 PF01399 Proteasome component region PCI
HMMSmart IPR000717 327 417 SM00088 Proteasome component region PCI
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp